setd1ba

Ensembl ID:
ENSDARG00000060847
ZFIN ID:
ZDB-GENE-050309-289
Description:
Histone-lysine N-methyltransferase SETD1B-A [Source:UniProtKB/Swiss-Prot;Acc:Q1LY77]
Human Orthologue:
SETD1B
Human Description:
SET domain containing 1B [Source:HGNC Symbol;Acc:29187]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12989 Nonsense Available for shipment Available now
sa13004 Nonsense Available for shipment Available now
sa34982 Nonsense Mutation detected in F1 DNA During 2018
sa714 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa12989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 22 1844 1 19
ENSDART00000086165 Nonsense 22 1844 1 19
Genomic Location (Zv9):
Chromosome 10 (position 43352037)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42158532
GRCz11 10 41986912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGATAGTGGTGTATTGTAAGAGACAGAAACCCCAGACTAGAGGCACA[C/T]AATATGTGTTGGCTCGCAAAAAGGAGGCAGTATCTTTAAAATCATGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 22 1844 1 19
ENSDART00000086165 Nonsense 22 1844 1 19
Genomic Location (Zv9):
Chromosome 10 (position 43352037)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42158532
GRCz11 10 41986912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGATAGTGGTGTATTGTAAGAGACAGAAACCCCAGACTAGAGGCACA[C/T]AATATGTGTTGGCTCGCAAAAAGGAGGCAGTATCTTTAAAATCATGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 354 1844 7 19
Genomic Location (Zv9):
Chromosome 10 (position 43360563)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42167058
GRCz11 10 41995438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGAGGCTACAAATCGAGGAGACATGAAACCAAATTCCAGGATGCCTA[C/A]AACCGTAGACCAGAAAGGCGATATGTCCATGGACCCACGCAACGTGGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa714
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086165 Nonsense 536 1844 7 19
Genomic Location (Zv9):
Chromosome 10 (position 43361107)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42167602
GRCz11 10 41995982
KASP Assay ID:
554-0622.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCCCGATCTCCTCCTCGTCATCCCAGCTGTCCCCAATCCCACCCCAG[C/T]GACCCTCRCGGCCTTCAAGCACTGGTCTGGAGGACATCAGCCCAACTCCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link