si:dkey-24l11.7

Ensembl ID:
ENSDARG00000060841
ZFIN ID:
ZDB-GENE-030328-39
Description:
Novel protein similar to vertebrate phosphoinositide-3-kinase, class 2, alpha polypeptide (PIK3C2A)
Human Orthologue:
PIK3C2A
Human Description:
phosphoinositide-3-kinase, class 2, alpha polypeptide [Source:HGNC Symbol;Acc:8971]
Mouse Orthologue:
Pik3c2a
Mouse Description:
phosphatidylinositol 3-kinase, C2 domain containing, alpha polypeptide Gene [Source:MGI Symbol;Acc:M

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6522 Nonsense Mutation detected in F1 DNA During 2018
sa10124 Nonsense Available for shipment Available now
sa25065 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12328 Nonsense Available for shipment Available now
sa679 Nonsense Available for shipment Available now
sa18446 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086131 Nonsense 579 1725 8 32
ENSDART00000133547 Nonsense 579 1725 9 33
Genomic Location (Zv9):
Chromosome 18 (position 26982525)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27055780
GRCz11 18 27038158
KASP Assay ID:
554-4679.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTCTCTTTTTAGAACAACCAATATAAAACAGTGGACAATGTGGTT[C/T]AGTCTGTTAAGAATCTGTSCTGTGCTCTGGATGAAGTTGAGACACCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086131 Nonsense 585 1725 8 32
ENSDART00000133547 Nonsense 585 1725 9 33
Genomic Location (Zv9):
Chromosome 18 (position 26982545)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27055800
GRCz11 18 27038178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCAATATAAAACAGTGGACAATGTGGTTYAGTCTGTTAAGAATCTGTS[C/A]TGTGCTCTGGATGAAGTTGAGACACCAGCCATCACTGATGCCGTCAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25065
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086131 Essential Splice Site 985 1725 16 32
ENSDART00000133547 Essential Splice Site 985 1725 17 33
Genomic Location (Zv9):
Chromosome 18 (position 26996706)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27069961
GRCz11 18 27052339
KASP Assay ID:
554-7869.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACCACTTTATTGGTTTTATAACCTGCTTTATGACTGGTTTGCTGTA[G/A]GTTTGCCGACACAGAGGTGAGGAAAGTGGCTGTGAGCTGGATCCAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086131 Nonsense 1236 1725 22 32
ENSDART00000133547 Nonsense 1236 1725 23 33
Genomic Location (Zv9):
Chromosome 18 (position 27006252)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27079507
GRCz11 18 27061885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAKTTGGTACCATCTTCTGAAACGCTGAGAAAGATTCAGGTGGAGTA[T/A]GGAGTGACGGGTTCCTTCAAGGACAAACCTCTTGCTGAGTGGCTTCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086131 Nonsense 1480 1725 27 32
ENSDART00000133547 Nonsense 1480 1725 28 33
Genomic Location (Zv9):
Chromosome 18 (position 27010652)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27083907
GRCz11 18 27066285
KASP Assay ID:
554-0587.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTAATAAAAATTCACCTGATTTCTTATGTTTYTTTGTTTTTAGACGTA[T/A]GTCATTCGGATTCTAAGGGAAGGTCAGAGCGAGCCACAGTTTGTTTTCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086131 Nonsense 1546 1725 28 32
ENSDART00000133547 Nonsense 1546 1725 29 33
Genomic Location (Zv9):
Chromosome 18 (position 27010940)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 27084195
GRCz11 18 27066573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACACATCAAGGATGTGGCATCCAAGAGAAAGGTTGAATTGAATARTTA[T/A]GTRCACAATCTGATGAGGAGTTCAACAGAGGTYGCCCAGGTGGGTATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link