si:dkeyp-81e1.5

Ensembl ID:
ENSDARG00000060837
ZFIN ID:
ZDB-GENE-091112-24
Human Orthologue:
TRPC5
Human Description:
transient receptor potential cation channel, subfamily C, member 5 [Source:HGNC Symbol;Acc:12337]
Mouse Orthologue:
Trpc5
Mouse Description:
transient receptor potential cation channel, subfamily C, member 5 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13112 Nonsense Available for shipment Available now
sa10159 Nonsense Available for shipment Available now
sa19266 Nonsense Mutation detected in F1 DNA During 2018
sa23990 Nonsense Available for shipment Available now
sa23991 Missense, Nonsense Available for shipment Available now
sa23992 Nonsense Available for shipment Available now
sa44972 Missense, Nonsense Mutation detected in F1 DNA During 2018
sa43685 Nonsense Mutation detected in F1 DNA During 2018
sa29635 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 59 781 1 12
ENSDART00000141770 Nonsense 74 428 1 5
ENSDART00000148115 Nonsense 91 1012 2 10
Genomic Location (Zv9):
Chromosome 21 (position 33133180)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34132873
GRCz11 21 34167363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATTATGCCGGAGTTAAACAGGCCCTTGAGGAGGCARATATMTATTA[C/A]AACATTAATGTGAACTGCCTAGACCCGTTAGGCCGCAGTGCGCTCCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 348 781 3 12
ENSDART00000141770 Nonsense 363 428 3 5
ENSDART00000148115 Nonsense 380 1012 4 10
ENSDART00000086115 Nonsense 348 781 3 12
ENSDART00000141770 Nonsense 363 428 3 5
ENSDART00000148115 Nonsense 380 1012 4 10
Genomic Location (Zv9):
Chromosome 21 (position 33141715)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34141408
GRCz11 21 34175898
KASP Assay ID:
2261-5870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACATGCTTCATCATTGGTCTGCTCTTCCCTGTATTCTCCATCATAYA[C/A]CTTCTGGCTCCAAAGAGCACACTGGGAACCTTTATTAAGAAACCATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 348 781 3 12
ENSDART00000141770 Nonsense 363 428 3 5
ENSDART00000148115 Nonsense 380 1012 4 10
ENSDART00000086115 Nonsense 348 781 3 12
ENSDART00000141770 Nonsense 363 428 3 5
ENSDART00000148115 Nonsense 380 1012 4 10
Genomic Location (Zv9):
Chromosome 21 (position 33141715)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34141408
GRCz11 21 34175898
KASP Assay ID:
2261-5870.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACATGCTTCATCATTGGTCTGCTCTTCCCTGTATTCTCCATCATATA[C/A]CTTCTGGCTCCAAAGAGCACACTGGGAACCTTTATTAAGAAACCATTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 418 781 3 12
ENSDART00000141770   None 428 None 5
ENSDART00000148115   None 1012 None 10
Genomic Location (Zv9):
Chromosome 21 (position 33141925)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34141618
GRCz11 21 34176108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTGAGTGGATGATCTTACCTTGGGTTCTAGGTAAGTCTTTTTGGTA[T/A]ACATTGAGTTCAAAAACAGGATAGATAGGTGGATGGATTGATGGATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23991
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Missense 470 781 6 12
ENSDART00000141770   None 428 5 5
ENSDART00000148115 Nonsense 468 1012 5 10
Genomic Location (Zv9):
Chromosome 21 (position 33142416)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34142109
GRCz10 KN150502.1 10813
GRCz11 21 34176599
GRCz11 KN150502.1 10813
KASP Assay ID:
2261-5872.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTGGAGTGGGAAATGTGGCACCCAACACTCATCGCTGAGGCTCTATT[T/A]GCTATTGCCAACATCTTCAGCTCCCTGCGTCTCATCTCTTTGTTCACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 507 781 6 12
ENSDART00000141770   None 428 5 5
ENSDART00000148115   504 1012 5 10
Genomic Location (Zv9):
Chromosome 21 (position 33142525)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34142218
GRCz10 KN150502.1 10704
GRCz11 21 34176708
GRCz11 KN150502.1 10704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGGGCCCACTGCAAATCTCTCTCGGTCGCATGTTGCTGGACATTCTC[A/T]AGTTCCTTTTCATCTACTGTTTGGTGCTTCTGGCCTTTGCCAATGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 530 781 6 12
ENSDART00000141770   None 428 5 5
ENSDART00000148115 Missense 528 1012 5 10
Genomic Location (Zv9):
Chromosome 21 (position 33142596)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34142289
GRCz10 KN150502.1 10633
GRCz11 21 34176779
GRCz11 KN150502.1 10633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGTGCTTCTGGCCTTTGCCAATGGCCTCAACCAACTCTATTTCTACTA[T/A]GAGACAAAGGCATCTGAAGAGCCCAACAACTGCAAAGGGATTCGTTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Nonsense 542 781 6 12
ENSDART00000141770   None 428 5 5
ENSDART00000148115   539 1012 5 10
Genomic Location (Zv9):
Chromosome 21 (position 33142630)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34142323
GRCz10 KN150502.1 10599
GRCz11 21 34176813
GRCz11 KN150502.1 10599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTATTTCTACTATGAGACAAAGGCATCTGAAGAGCCCAACAACTGC[A/T]AAGGGATTCGTTGTGAAAAGCAGAATAACGCCTTTTCCACGTGAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29635
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086115 Splice Site 555 781 7 12
ENSDART00000141770   None 428 None 5
ENSDART00000148115 Essential Splice Site 553 1012 6 10
Genomic Location (Zv9):
Chromosome 21 (position 33161493)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34161186
GRCz11 21 34195676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTGCTTTTGCACCTTTCATTAATTTATTCTCTCTTTGACTTCACAG[G/A]CTCTTCGAAACTCTTCAGTCTCTCTTCTGGTCTGTGTTCGGGCTGTTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link