si:ch211-199g17.1

Ensembl ID:
ENSDARG00000060830
ZFIN ID:
ZDB-GENE-030131-6729
Description:
Protein FAM83H [Source:UniProtKB/Swiss-Prot;Acc:Q1LVV0]
Human Orthologue:
FAM83H
Human Description:
family with sequence similarity 83, member H [Source:HGNC Symbol;Acc:24797]
Mouse Orthologue:
Fam83h
Mouse Description:
family with sequence similarity 83, member H Gene [Source:MGI Symbol;Acc:MGI:2145900]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36912 Nonsense Available for shipment Available now
sa43341 Nonsense Mutation detected in F1 DNA During 2018
sa23591 Nonsense Available for shipment Available now
sa32261 Nonsense Available for shipment Available now
sa23592 Nonsense Available for shipment Available now
sa23593 Nonsense Available for shipment Available now
sa43342 Nonsense Mutation detected in F1 DNA During 2018
sa31037 Nonsense Mutation detected in F1 DNA During 2018
sa43343 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 250 1170 4 5
ENSDART00000138009 Nonsense 250 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44966537)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44021518
GRCz11 19 43617115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATCTGACATTGTACATTTTTTTTTTTCTCTTTTCCCAGCTTTATGT[G/A]GTCTTTTGAGAAGATCCACCGCTGTATCGCCCATTTATTCCTTGGAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 403 1170 4 5
ENSDART00000138009 Nonsense 403 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44966997)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44021058
GRCz11 19 43616655
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAATGCTTTTAAAAGGCATAGCTATGCAGAAGGCACCCGCGAGACCTA[C/A]GCCTCCTCCCGGCAGTACATGAAACAGCGTGTAATGAACAACTTGGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23591
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 427 1170 4 5
ENSDART00000138009 Nonsense 427 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44967067)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44020988
GRCz11 19 43616585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAACAGCGTGTAATGAACAACTTGGAAGAGACTGAATCGCATTACCAG[C/T]GAGAACAACATTATTATCAGAGTGAAGGCATGGGACATGATGACCGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 447 1170 4 5
ENSDART00000138009 Nonsense 447 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44967127)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44020928
GRCz11 19 43616525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATTATCAGAGTGAAGGCATGGGACATGATGACCGTGGACACTACGAC[C/T]GATTTAACTATGGCTTGGCAGATCAACACTCAGATTCTGGATATCCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 485 1170 4 5
ENSDART00000138009 Nonsense 485 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44967241)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44020814
GRCz11 19 43616411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAAATATAAATGTTTTATCCTCGGATGACCTCAAAAGTGATTCAGAA[A/T]AACAGTATAACATAGGAGGTCGCTATGATCCACAAGGCCACAAGAGGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 761 1170 4 5
ENSDART00000138009 Nonsense 761 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44968069)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44019986
GRCz11 19 43615583
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATAAACATAAAAAAGCAGATGAAAAAGATGTTAAACACGCTTCAACC[G/T]GAGATCTGACTACGATCCAAGACACCAAAGAAGAGCCCATCAAAGAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 844 1170 4 5
ENSDART00000138009 Nonsense 844 1192 5 5
ENSDART00000086138 Nonsense 844 1170 4 5
ENSDART00000138009 Nonsense 844 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44968318)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44019737
GRCz11 19 43615334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCAAATTAGAGTTAGATTTGGGTACAAAAAGTCAAGAAGCAGCCATT[A/T]AAAAGCCAGAAACCTTGGATACAGCAACCAAAGTTCCAGATGTGCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 844 1170 4 5
ENSDART00000138009 Nonsense 844 1192 5 5
ENSDART00000086138 Nonsense 844 1170 4 5
ENSDART00000138009 Nonsense 844 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44968318)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44019737
GRCz11 19 43615334
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCAAATTAGAGTTAGATTTGGGTACAAAAAGTCAAGAAGCAGCCATT[A/T]AAAAGCCAGAAACCTTGGATACAGCAACCAAAGTTCCAGATGTGCTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086138 Nonsense 901 1170 4 5
ENSDART00000138009 Nonsense 901 1192 5 5
Genomic Location (Zv9):
Chromosome 19 (position 44968491)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44019564
GRCz11 19 43615161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTGAAACAAAACCAAAACCATCAGAAGTCTCTGTGGACAGACCCTA[C/A]ACCACCAACAAAACTCTAACGGAGAGCATAGCTGATGCACCAAAGAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link