si:dkey-37m8.10

Ensembl ID:
ENSDARG00000060805
ZFIN ID:
ZDB-GENE-030131-3982
Description:
Novel protein similar to vertebrate microtubule-associated protein 1B (MAP1B) [Source:UniProtKB/TrEM
Human Orthologue:
MAP1S
Human Description:
microtubule-associated protein 1S [Source:HGNC Symbol;Acc:15715]
Mouse Orthologue:
Mtap1s
Mouse Description:
microtubule-associated protein 1S Gene [Source:MGI Symbol;Acc:MGI:2443304]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37570 Nonsense Available for shipment Available now
sa11714 Nonsense Available for shipment Available now
sa17845 Nonsense Available for shipment Available now
sa29837 Nonsense Mutation detected in F1 DNA During 2018
sa43883 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37570
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086064 Nonsense 384 1311 5 7
Genomic Location (Zv9):
Chromosome 22 (position 39685570)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36862203
GRCz11 22 36802948
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTGACCCTAGGGTCCTCAGAAGTTCTGATCAGGTTTCTCTAACATTA[C/T]AGCATTTAGAAAAGTTGTCGATATTTCCAGAACGGCTCAGTCGATCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086064 Nonsense 712 1311 5 7
Genomic Location (Zv9):
Chromosome 22 (position 39684586)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36861219
GRCz11 22 36801964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTAAAAAGGATCCTGTAACTAAAGGGAAACCAAAGCCAGACAAAAAG[G/T]AGCCTGACAATGTGAAGTCCTCAAGTGGRGACAAWTCAAAGACWTCCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086064 Nonsense 768 1311 5 7
Genomic Location (Zv9):
Chromosome 22 (position 39684418)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36861051
GRCz11 22 36801796
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGAGGGAAACAATATGAGCTCAAGAACTGCCTCTGACWGCAGCGCTGGG[C/T]AAGTGAACGGCTCTAAAACTGGTACTGAGGAAAGTCCAGAGAAGTTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086064 Nonsense 1076 1311 5 7
Genomic Location (Zv9):
Chromosome 22 (position 39683492)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36860125
GRCz11 22 36800870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTTATTTCGGTTTCTGATTCTGACGTGCCGCCAGCCACTGAAGAGTG[T/A]CCTTCTATTAGTGAGGAGTTGGACTCTGAAGAGGACACTACTAGTGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086064 Essential Splice Site 1213 1311 5 7
Genomic Location (Zv9):
Chromosome 22 (position 39683081)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36859714
GRCz11 22 36800459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGTGCTATTGGTGGATCTAGGCCAACGTCTTCCAAGTCCTCATCCAG[T/C]AAGTGGCCTTTTGTGCTGGGACATTCATTAGTATATATTTGTGGCCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link