zgc:152990

Ensembl ID:
ENSDARG00000060796
ZFIN IDs:
ZDB-GENE-060929-828, ZDB-GENE-060929-828
Description:
sodium-dependent phosphate transporter 2 [Source:RefSeq peptide;Acc:NP_001071014]
Human Orthologue:
SLC20A2
Human Description:
solute carrier family 20 (phosphate transporter), member 2 [Source:HGNC Symbol;Acc:10947]
Mouse Orthologue:
Slc20a2
Mouse Description:
solute carrier family 20, member 2 Gene [Source:MGI Symbol;Acc:MGI:97851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21321 Nonsense Available for shipment Available now
sa34429 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086044 Nonsense 79 496 2 12
ENSDART00000086047 Nonsense 79 496 2 11
Genomic Location (Zv9):
Chromosome 8 (position 30667321)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29810047
GRCz11 8 29819279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGCCAAGGTCGGGGAAACCATCCGGAAGGGAATTATAGACGTCAGTT[T/A]GTACAATGACACAGTGCCCATACTGATGGCGGGAGAGGTCAGCGCCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34429
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086044 Missense 361 496 8 12
ENSDART00000086047 Essential Splice Site 360 496 None 11
Genomic Location (Zv9):
Chromosome 8 (position 30647544)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 29790270
GRCz11 8 29799502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGTTTACCATACCGTCCACAAAGACTCTGGTCTCTACAAAGACCTCC[T/A]GCACAAAATCCACAAGGGCCGCCTGGAGGATGAGCGCCACGGCTCCCGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link