si:dkey-231l1.3

Ensembl ID:
ENSDARG00000060788
ZFIN ID:
ZDB-GENE-060503-910
Description:
Leucine-rich repeat-containing protein 14B [Source:UniProtKB/Swiss-Prot;Acc:Q1L8H0]
Human Orthologue:
LRRC14B
Human Description:
leucine rich repeat containing 14B [Source:HGNC Symbol;Acc:37268]
Mouse Orthologue:
Lrrc14b
Mouse Description:
leucine rich repeat containing 14B Gene [Source:MGI Symbol;Acc:MGI:2145269]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1719 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086040 Nonsense 80 526 1 3
Genomic Location (Zv9):
Chromosome 19 (position 45546399)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44444621
GRCz11 19 44040194
KASP Assay ID:
554-1665.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTGTTAGGAAAGACGAYGGACTGTCCTGAAGACCTCACGTGCAGCACTTG[C/A]AGGCTCTGTCTTGAAGCGTTTCTCACAGGYTTGAGGGACTATGTGCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link