zgc:158219

Ensembl ID:
ENSDARG00000060785
ZFIN ID:
ZDB-GENE-070209-185
Description:
Pecanex-like protein C14orf135 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2RUW7]
Human Orthologue:
C14orf135
Human Description:
chromosome 14 open reading frame 135 [Source:HGNC Symbol;Acc:20349]
Mouse Orthologue:
1810048J11Rik
Mouse Description:
RIKEN cDNA 1810048J11 gene Gene [Source:MGI Symbol;Acc:MGI:1914958]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28141 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086018 Essential Splice Site 504 1225 5 11

The following transcripts of ENSDARG00000060785 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 31753649)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31399597
GRCz11 13 31530047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACACACAGCCTCTCTTGCCATTGGCTTCACTCGGGCATTCAGGATGG[T/G]ATGAGATTTTATGTCTTAAGATTATCCTAAAGCATTATTAGCAGGTTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link