A1L2D4_DANRE

Ensembl ID:
ENSDARG00000060771
Description:
LOC794500 protein [Source:UniProtKB/TrEMBL;Acc:A1L2D4]
Human Orthologue:
MAP7D3
Human Description:
MAP7 domain containing 3 [Source:HGNC Symbol;Acc:25742]
Mouse Orthologue:
Mtap7d3
Mouse Description:
MAP7 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2445051]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45518 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45518
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085962   None 606 None 15
ENSDART00000085977   None 452 None 13
ENSDART00000127303 Nonsense 242 838 8 21
Genomic Location (Zv9):
Chromosome 14 (position 32563013)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31352820
GRCz11 14 31693134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTGAGCTTTCTTTTGTCCCTCAGGTGCAAAGCGGAGAAGTTCTTCTT[T/A]GAACCGGTTGCCTAGCAATGCTCCTCAGGCCTCTAAAGAAGCACATAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link