si:dkey-231l1.6

Ensembl ID:
ENSDARG00000060768
ZFIN ID:
ZDB-GENE-060503-156
Description:
Ankyrin repeat and IBR domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q1L8G6]
Human Orthologue:
ANKIB1
Human Description:
ankyrin repeat and IBR domain containing 1 [Source:HGNC Symbol;Acc:22215]
Mouse Orthologue:
Ankib1
Mouse Description:
ankyrin repeat and IBR domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918047]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5929 Nonsense Mutation detected in F1 DNA During 2018
sa36917 Nonsense Available for shipment Available now
sa23595 Nonsense Available for shipment Available now
sa23596 Essential Splice Site Available for shipment Available now
sa6124 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17107 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5929
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 436 1053 8 20
ENSDART00000133628 Nonsense 436 1060 9 20
Genomic Location (Zv9):
Chromosome 19 (position 45444431)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44342653
GRCz11 19 43938226
KASP Assay ID:
554-3931.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCCACTGGTGCCCTGTAGCCAGATGTGAAAGAGCCGTTCGTCTGACT[C/T]GACCAGGCCCTGGAGCTTCTGACCCGCTGAGCTTCCCGTTGCTGAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 477 1053 9 20
ENSDART00000133628 Nonsense 477 1060 10 20
Genomic Location (Zv9):
Chromosome 19 (position 45448806)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44347028
GRCz11 19 43942601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTGTCTCTCAGGGAGTGTCTTGGGGATGCTCATGAACCCTGTGACTG[T/A]GAAACATGGAAGATGTGGCTGCAGAAAGTGTCTGAGATGAAGCCTGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Nonsense 500 1053 10 20
ENSDART00000133628 Nonsense 500 1060 11 20
Genomic Location (Zv9):
Chromosome 19 (position 45449425)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44347647
GRCz11 19 43943220
KASP Assay ID:
2261-3699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATCATAAGACTTCATCTGCATCTCTCTGAACAGTGGCTGGTGTGAGC[G/T]AAGCTTATGAAGATGCTGCCAACTGCCTGTGGTTACTCTCCAACTCCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980 Essential Splice Site 743 1053 16 20
ENSDART00000133628 Essential Splice Site 743 1060 17 20
Genomic Location (Zv9):
Chromosome 19 (position 45458121)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44356343
GRCz11 19 43951916
KASP Assay ID:
2261-3700.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTATTTCTAAAGATCATCTGTGTTATCATAATTTTCCCCTCTTTTTCA[G/A]TTTTGCTGGCGGGACGTGGGACTGGGAGTATCTGGGATTTGCTTCTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980   None 1053 None 20
ENSDART00000133628 Essential Splice Site 824 1060 18 20
Genomic Location (Zv9):
Chromosome 19 (position 45461351)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44359573
GRCz11 19 43955146
KASP Assay ID:
554-3823.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACATGAACGAGCCACTGAACGACACTCATACTCACTCTGAAATATGT[G/A]TGTGTTTGTGTTTATAGAAACACATGAGGGAGGCACTTCACAACGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085980   None 1053 None 20
ENSDART00000133628 Nonsense 1050 1060 20 20
Genomic Location (Zv9):
Chromosome 19 (position 45466618)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 44364840
GRCz11 19 43960413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACATAAAATCAGTTCTGGTGGCCTTAGACGAAATGTGTTTTCTTTGGGT[C/T]GAAGATGGAAGGGGTTTTCATGCAKTACAAAATAAGGGCGYAATACAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link