smg7

Ensembl ID:
ENSDARG00000060767
ZFIN ID:
ZDB-GENE-030131-9122
Description:
protein SMG7 [Source:RefSeq peptide;Acc:NP_001038548]
Human Orthologue:
SMG7
Human Description:
Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) [Source:HGNC Symbol;Acc:16792]
Mouse Orthologue:
Smg7
Mouse Description:
Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2682

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32963 Essential Splice Site Mutation detected in F1 DNA During 2018
sa853 Nonsense F2 line generated During 2018
sa19816 Essential Splice Site Available for shipment Available now
sa18100 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085976 Essential Splice Site 20 1130 2 22
Genomic Location (Zv9):
Chromosome 2 (position 35773618)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36070328
GRCz11 2 36052785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTGTTTTGAGCAGGCAGGCAGAGGCCCTGAAGGCTGACATGACAGG[T/C]ATGTTACTATGTCCTTTAATGTATTTACTTTAAAATGTTTGTTAAAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa853
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085976 Nonsense 33 1130 3 22
Genomic Location (Zv9):
Chromosome 2 (position 35774025)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36070735
GRCz11 2 36053192
KASP Assay ID:
554-0756.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTCATGCAGATTCTAAGCTTGGTGCCGCGGAGGTCTGGACGTCACGA[C/T]AGGCTCTTCAGGACTTGTACCAGAAAATGCTGGTTACGGACCTGGAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19816
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085976 Essential Splice Site 335 1130 10 22
Genomic Location (Zv9):
Chromosome 2 (position 35782936)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36079646
GRCz11 2 36062103
KASP Assay ID:
2259-2308.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAAGCATTATTTTGTGCAATATTGTGATGTTCTGATGGTCTTTCCCCA[G/T]TGTCTTTTCTGGGAGTGATGCTAAGTCGAGCTTTACTGAATAAGAACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18100
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085976 Nonsense 937 1130 19 22
Genomic Location (Zv9):
Chromosome 2 (position 35793632)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36090342
GRCz11 2 36072799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGAAACAATATTTAWGTTTGCTGCTGTTTTACAGGATAACTCCTAC[C/T]ARAAYAACAGCATTTTTAGTGAGGCCTACGGTAAAAACATGACACCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link