
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000060754
- Ensembl ID:
- ENSDARG00000060754
- Human Orthologue:
- ST14
- Human Description:
- suppression of tumorigenicity 14 (colon carcinoma) [Source:HGNC Symbol;Acc:11344]
- Mouse Orthologue:
- St14
- Mouse Description:
- suppression of tumorigenicity 14 (colon carcinoma) Gene [Source:MGI Symbol;Acc:MGI:1338881]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24739 | Nonsense | Available for shipment | Available now |
sa32549 | Nonsense | Available for shipment | Available now |
sa44369 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa24739
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085942 | Nonsense | 235 | 841 | 7 | 20 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3455 (position 307978)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 37155254 GRCz11 15 37056868 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAAGAGTTCTCGTCTCCAGGAAACCCTAAGTCATACCCAGCTTACTCC[C/T]GATGCCAGTGGCAGATCCGCGCCAATAAAGGCTCCGCCATCATTGTCAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32549
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085942 | Nonsense | 444 | 841 | 12 | 20 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3455 (position 315431)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 37147801 GRCz11 15 37049415 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCCTTACTGTTTTCCTGTTTTCACCCTCACTGATGTTATCTCCAGCTTG[C/A]CCTGGTCAGTTTGCTTGCAGTTCAGGCTATTGTATCAGAAAAGAGCAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44369
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085942 | Nonsense | 517 | 841 | 14 | 20 |
- Genomic Location (Zv9):
- Chromosome Zv9_scaffold3455 (position 318989)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 37144243 GRCz11 15 37045857 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTGAAGGATACTTACCCTTGTTTTGCTTAATTTTCCCATAGACTGTGGC[A/T]GAGCACAGGTGAGGTGTGGCAACGGCGCCTGCATCATGCAGGATTTTGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: