
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
BTBD2 (1 of 2)
- Ensembl ID:
- ENSDARG00000060750
- Description:
- BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:15504]
- Human Orthologue:
- BTBD2
- Human Description:
- BTB (POZ) domain containing 2 [Source:HGNC Symbol;Acc:15504]
- Mouse Orthologue:
- Btbd2
- Mouse Description:
- BTB (POZ) domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1933831]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6022 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa18657 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6022
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085917 | Essential Splice Site | 232 | 584 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 57026885)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 57011778 GRCz11 2 57225000 - KASP Assay ID:
- 554-3673.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGCACGCATGYGTTACACTTTCCAGAAATATGCAGATCTTGTTTCTCCTC[A/T]GATTCCTGTACTCTGATGAAGTTCATATCGGACCCGAGACRGTGATGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18657
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085917 | Essential Splice Site | 483 | 584 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 2 (position 57014331)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 56999224 GRCz11 2 57212446 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATTTCCTCCAGMAACTGTAMAGACTGTGACGCTGTGTGTTTTATTTTC[A/T]GATCATTCACACYGACAGTAACACAGTWCTGGGTCAGAACGACACKGGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: