zgc:158429

Ensembl ID:
ENSDARG00000060748
ZFIN ID:
ZDB-GENE-061215-17
Description:
Elongation factor Ts, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:A1A5Z3]
Human Orthologue:
TSFM
Human Description:
Ts translation elongation factor, mitochondrial [Source:HGNC Symbol;Acc:12367]
Mouse Orthologue:
Tsfm
Mouse Description:
Ts translation elongation factor, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1913649]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20767 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20767
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085945 Nonsense 247 311 6 6
Genomic Location (Zv9):
Chromosome 6 (position 39829272)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39900872
GRCz11 6 39898408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAGGTGAACCTAAGGAAGGGACATACGCTCTTGGAAGGAAGCTGGCA[C/T]AACATGTAATGGGTGAAGCACCTGTTTCTCTTGGCAACATGGACGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link