
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
pgm5
- Ensembl ID:
- ENSDARG00000060745
- ZFIN ID:
- ZDB-GENE-060503-838
- Description:
- phosphoglucomutase-like protein 5 [Source:RefSeq peptide;Acc:NP_001119868]
- Human Orthologue:
- PGM5
- Human Description:
- phosphoglucomutase 5 [Source:HGNC Symbol;Acc:8908]
- Mouse Orthologue:
- Pgm5
- Mouse Description:
- phosphoglucomutase 5 Gene [Source:MGI Symbol;Acc:MGI:1925668]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13857 | Essential Splice Site | Available for shipment | Available now |
sa21326 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa13857
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085894 | Essential Splice Site | 493 | 567 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31339866)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30482592 GRCz11 8 30491824 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAAATTAGCAYTAAATGGTCTACATTCRTACTTTTTGTTCTTGTCCYGC[A/G]GGGCCTAAGGATCATCTTTACCGATTCATCSCGAATCATCTTTCGGCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21326
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085894 | Splice Site, Nonsense | 538 | 567 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 8 (position 31340003)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 30482729 GRCz11 8 30491961 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTATGCTGAAAGCTACGAGAGAGACCCTGAAAGACACAACAGAGAGACT[C/T]AGGTGAATACAGGATCTTCACTTTGGCTCACAGTCTGTCACTGTATCTCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: A genome-wide association study of seasonal pattern mania identifies NF1A as a possible susceptibility gene for bipolar disorder. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: