stim1a

Ensembl ID:
ENSDARG00000060723
ZFIN ID:
ZDB-GENE-060503-914
Description:
stromal interaction molecule 1 [Source:RefSeq peptide;Acc:NP_001038264]
Human Orthologue:
STIM1
Human Description:
stromal interaction molecule 1 [Source:HGNC Symbol;Acc:11386]
Mouse Orthologue:
Stim1
Mouse Description:
stromal interaction molecule 1 Gene [Source:MGI Symbol;Acc:MGI:107476]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35971 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085865 Nonsense 346 703 8 14
ENSDART00000122134 Nonsense 346 676 9 13
Genomic Location (Zv9):
Chromosome 15 (position 36986458)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38386462
GRCz11 15 38288047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTCTCGCAGCAGTTGGTCTCCTCCTGAAGCTCTGCAGAAATGGCTG[C/T]AGCTTACTCATGAGGTGGAGGTGCAGTACTACAACATCAAGAAGCAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link