zgc:165571

Ensembl ID:
ENSDARG00000060682
ZFIN ID:
ZDB-GENE-030131-7249
Description:
hypothetical protein LOC335309 [Source:RefSeq peptide;Acc:NP_001092702]
Human Orthologue:
AGR2
Human Description:
anterior gradient homolog 2 (Xenopus laevis) [Source:HGNC Symbol;Acc:328]
Mouse Orthologue:
Agr2
Mouse Description:
anterior gradient 2 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1344405]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27479 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27478 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27479
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085763 Essential Splice Site 98 168 None 8
ENSDART00000139019 Essential Splice Site 98 105 None 7
ENSDART00000085763 Essential Splice Site 98 168 None 8
ENSDART00000139019 Essential Splice Site 98 105 None 7
Genomic Location (Zv9):
Chromosome 9 (position 46665737)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45797017
GRCz11 9 45597496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCTAAAACAGCACAGATATTCACAAGAGTTTTGTGATTGTGAATTTC[A/C]GCATGAGACCACCGATACCCACTTGGCCCCAGATGGCTTCTACGTTCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085763 Essential Splice Site 98 168 None 8
ENSDART00000139019 Essential Splice Site 98 105 None 7
ENSDART00000085763 Essential Splice Site 98 168 None 8
ENSDART00000139019 Essential Splice Site 98 105 None 7
Genomic Location (Zv9):
Chromosome 9 (position 46665737)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45797017
GRCz11 9 45597496
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCTAAAACAGCACAGATATTCACAAGAGTTTTGTGATTGTGAATTTC[A/C]GCATGAGACCACCGATACCCACTTGGCCCCAGATGGCTTCTACGTTCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link