si:dkey-79p17.2

Ensembl ID:
ENSDARG00000060671
ZFIN ID:
ZDB-GENE-081104-434
Description:
Novel protein similar to vertebrate lactase (LCT) [Source:UniProtKB/TrEMBL;Acc:B0UYB8]
Human Orthologue:
LCT
Human Description:
lactase [Source:HGNC Symbol;Acc:6530]
Mouse Orthologue:
Lct
Mouse Description:
lactase Gene [Source:MGI Symbol;Acc:MGI:104576]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2489 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2489
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085738 Nonsense 1109 1900 8 17
ENSDART00000144512 Nonsense 802 1593 3 12
Genomic Location (Zv9):
Chromosome 9 (position 47576430)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 46575233
GRCz11 9 46375712
KASP Assay ID:
554-2761.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGAACCCCTGGATGTCAACATCCCTCGAGAGGTTGTGGCTGCAGAC[C/T]GAGCCCTTCAGTTCCAACTAGGTTGGTYTGCACAYCCCATATTTAAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link