si:dkeyp-55c8.1

Ensembl ID:
ENSDARG00000060637
ZFIN IDs:
ZDB-GENE-070911-2, ZDB-GENE-070912-654
Description:
calsyntenin-2 [Source:RefSeq peptide;Acc:NP_001153311]
Human Orthologue:
CLSTN2
Human Description:
calsyntenin 2 [Source:HGNC Symbol;Acc:17448]
Mouse Orthologue:
Clstn2
Mouse Description:
calsyntenin 2 Gene [Source:MGI Symbol;Acc:MGI:1929897]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25875 Nonsense Mutation detected in F1 DNA During 2018
sa19831 Nonsense Available for shipment Available now
sa45114 Nonsense Mutation detected in F1 DNA During 2018
sa19832 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085675 Nonsense 179 937 4 17
Genomic Location (Zv9):
Chromosome 2 (position 39098281)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39428446
GRCz11 2 39394085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGACAGCATCCTGCAGGTGGAGGCCTGGGATCAGGACTGCTCTCCA[C/T]AGTACAGCCAGATCTGCAACTATGAGATTGTCACACAGGATACACCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085675 Nonsense 245 937 5 17
Genomic Location (Zv9):
Chromosome 2 (position 39115301)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39445466
GRCz11 2 39411105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGGCGATGGAGAGCGTTCCAGTTCACATTGACGTCAAACCAGTGTG[C/A]AAGCCAGGCTGGCAAGGTCAGTGGATACTTAATCTGTTGACTTATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45114
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085675 Nonsense 353 937 7 17
Genomic Location (Zv9):
Chromosome 2 (position 39138409)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39468574
GRCz11 2 39434213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGACAGTGGCCGAGACAGTGACCTCATCTTCCGATTTGATGGACGA[C/T]AGGCAGCCAACATCCCAGATTGGGTTGTGCCACAGAACCTGACAGATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085675 Essential Splice Site 399 937 8 17
Genomic Location (Zv9):
Chromosome 2 (position 39147346)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 39477511
GRCz11 2 39443150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGTATTTGACGCATGTACAATAATGCTTCTCTGTGTTTTCTTTTCGC[A/T]GAGATGAACAGACATCATTATTCTCTGTATGTCCACAACTGCCGTCTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Multiple sclerosis (OCB status): Oligoclonal band status in Scandinavian multiple sclerosis patients is associated with specific genetic risk alleles. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link