NP_001082871.1

Ensembl ID:
ENSDARG00000060632
Description:
ubiquitin carboxyl-terminal hydrolase 43 [Source:RefSeq peptide;Acc:NP_001082871]
Human Orthologue:
USP43
Human Description:
ubiquitin specific peptidase 43 [Source:HGNC Symbol;Acc:20072]
Mouse Orthologue:
Usp43
Mouse Description:
ubiquitin specific peptidase 43 Gene [Source:MGI Symbol;Acc:MGI:2444541]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45247 Nonsense Mutation detected in F1 DNA During 2018
sa33838 Nonsense Mutation detected in F1 DNA During 2018
sa40665 Nonsense Mutation detected in F1 DNA During 2018
sa9269 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085669 Nonsense 13 1154 1 15
ENSDART00000112731   None 1011 None 15
Genomic Location (Zv9):
Chromosome 6 (position 18260791)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23193491
GRCz11 6 19664812
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACGGACTAAACATGGATTCGCTGAGGGAAACCAGGAAACAAACAATC[A/T]AAGCTAAATCGGCGAAGCGCAAGAACAAAACGCACAAGTCCCAAAAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085669 Nonsense 579 1154 11 15
ENSDART00000112731 Nonsense 439 1011 11 15
Genomic Location (Zv9):
Chromosome 6 (position 18489111)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23039439
GRCz11 6 19510760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGAGGATGCAGAGAGTGTGAGAATCCAGCAGCAGAATCATGTACAA[C/T]AGCACAGCTGCACACTGGATGACTGTTTTCAGCTCTACACCAAAGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085669 Nonsense 916 1154 15 15
ENSDART00000112731 Nonsense 773 1011 15 15
Genomic Location (Zv9):
Chromosome 6 (position 18517760)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23010790
GRCz11 6 19482111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAACAGCCAAATCTTCCAGCCACAGTGGCCTCAGACCTCCAGAATA[T/G]CTGAAAATACCACAGGGTCAAGAAAGAAGTAGCTCAGAGAAAGCAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085669 Nonsense 935 1154 15 15
ENSDART00000112731 Nonsense 792 1011 15 15
Genomic Location (Zv9):
Chromosome 6 (position 18517815)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23010735
GRCz11 6 19482056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATACCACAGGGTCAAGAAAGAAGTAGCTCAGAGAAAGCAATGGGCCAA[C/T]AACCTGCCAGCAGCAGTAGATCAAGAGAAGAAGGGACYTTGACCAGACGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link