
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001038780.1
- Ensembl ID:
- ENSDARG00000060626
- Description:
- diacylglycerol kinase alpha [Source:RefSeq peptide;Acc:NP_001038780]
- Human Orthologue:
- DGKA
- Human Description:
- diacylglycerol kinase, alpha 80kDa [Source:HGNC Symbol;Acc:2849]
- Mouse Orthologue:
- Dgka
- Mouse Description:
- diacylglycerol kinase, alpha Gene [Source:MGI Symbol;Acc:MGI:102952]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17147 | Essential Splice Site | Available for shipment | Available now |
sa29975 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa8725 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa16576 | Nonsense | Available for shipment | Available now |
sa45808 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa17147
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085642 | Essential Splice Site | 371 | 727 | 13 | 24 |
ENSDART00000134883 | Essential Splice Site | 320 | 676 | 10 | 21 |
ENSDART00000143013 | None | 90 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 23 (position 32488851)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 32323741 GRCz11 23 32250272 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGATGATGACAGTGAGCTCAACACCACACCTGATGGRCAGGTGCTGCGGG[T/C]AGGACTCTGATAYATCTCTACWACTGCATCCACACACKGAAYGATGAGRG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29975
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085642 | Nonsense | 388 | 727 | 14 | 24 |
ENSDART00000134883 | Nonsense | 337 | 676 | 11 | 21 |
ENSDART00000143013 | None | 90 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 23 (position 32488717)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 32323607 GRCz11 23 32250138 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGATCAGCCCCATTCCAGACACTCGTCCTCTTTTGGTGTTTGTCAATCCT[A/T]AAAGTGGAGGTAAACAGGGAGAAAGGTGAGAACACGTATATCCATCTAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8725
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085642 | Nonsense | 422 | 727 | 16 | 24 |
ENSDART00000134883 | Nonsense | 371 | 676 | 13 | 21 |
ENSDART00000143013 | None | 90 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 23 (position 32487238)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 32322128 GRCz11 23 32248659 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACACTTGAAGGTGGTCATAATCGATTTAATACTCTGTTTTCAAACCAGGT[T/A]GAGTTTCTTCAGAGACGTGCCGAATTACAGAATATTAGTTTGCGGAGGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16576
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085642 | Nonsense | 522 | 727 | 18 | 24 |
ENSDART00000134883 | Nonsense | 471 | 676 | 15 | 21 |
ENSDART00000143013 | None | 90 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 23 (position 32484923)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 32319813 GRCz11 23 32246344 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATACAGGTGACTCTGGAGGACAGTCAGGAGAGAGGAGACCCTGTGCCCTA[C/A]GAAATCATCAAMAACTATTTCTCCATCGGAGTGGTGAGACTYGTAGAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45808
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085642 | Nonsense | 651 | 727 | 22 | 24 |
ENSDART00000134883 | Nonsense | 600 | 676 | 19 | 21 |
ENSDART00000143013 | None | 90 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 23 (position 32480672)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 32315562 GRCz11 23 32242093 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAAAACACTTAACCAACTGTCTCTGAACAGATATGAGTGATAAACGAT[T/A]GGAAGTGGTGGGACTGGAAGGAGCCATGGAGATGGGACAGATTTACACCG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Vitiligo: Association analyses identify three susceptibility Loci for vitiligo in the Chinese Han population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: