SOLH

Ensembl ID:
ENSDARG00000060600
Description:
small optic lobes homolog (Drosophila) [Source:HGNC Symbol;Acc:11182]
Human Orthologue:
SOLH
Human Description:
small optic lobes homolog (Drosophila) [Source:HGNC Symbol;Acc:11182]
Mouse Orthologue:
Solh
Mouse Description:
small optic lobes homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1355075]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19352 Nonsense Mutation detected in F1 DNA During 2018
sa8803 Nonsense Mutation detected in F1 DNA During 2018
sa14132 Nonsense Available for shipment Available now
sa44189 Nonsense Mutation detected in F1 DNA During 2018
sa37958 Nonsense Mutation detected in F1 DNA During 2018
sa19353 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 49 1122 2 12
ENSDART00000085565 Nonsense 49 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40631008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39163240
GRCz11 24 39051003
KASP Assay ID:
554-6219.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTCATTCACCTGGTTCGATGGAAGCAGTTGTGAGGAATTCTGATTG[G/A]TCCTGCGGGCGCTGCACGTTCCTCAACTCCAGCGGCTCTATGCGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8803
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 49 1122 2 12
ENSDART00000085565 Nonsense 49 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40631008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39163240
GRCz11 24 39051003
KASP Assay ID:
554-6219.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTCATTCACCTGGTTCGATGGAAGCAGTTGTGAGGAATTCTGATTG[G/A]TCCTGCGGGCGCTGCACGTTCCTCAACTCCAGCGGCTCYATGCGCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14132
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 253 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40631619)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39163851
GRCz11 24 39051614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCACCRTCTGAAACCCCATCTCCACCCCCTGTCCCRTTTCTGCCCCCYT[C/A]GTTGTCCKCACTTCAAAATAATCCTGTGCCTCGCAGCCGAAGAGAAGTYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44189
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 453 1122 2 12
Genomic Location (Zv9):
Chromosome 24 (position 40632218)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39164450
GRCz11 24 39052213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCTCGTCCTCCATTTCGTCCCCGTCGGCGCAGGACAAGAGTGTGTGC[C/T]AGTGGACGTGTCCTGCCTGCACGCTGCTGAACGAGGGAAGGATGAAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 571 1122 3 12
Genomic Location (Zv9):
Chromosome 24 (position 40641819)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39174051
GRCz11 24 39061814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTCCTCATGAGATCAACTGCAATAACTTTAAGGATCGCGGTGTGAAGTG[G/A]TCTGTGTTCAGGACACCCCGTCCCTCAGATATTCTGCAAGGCCTTCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085565 Nonsense 645 1122 4 12
Genomic Location (Zv9):
Chromosome 24 (position 40644770)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 39177002
GRCz11 24 39064765
KASP Assay ID:
554-6220.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATGTGGACCACCGTTTTAGTGGACGACATGCTGCCCTGTGACGAATA[C/A]GGCTTTCTGCTCTTCTCGCAGGTTTGTTCTGCTGTAGTTTCTTAAAGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link