zgc:158138

Ensembl ID:
ENSDARG00000060594
ZFIN ID:
ZDB-GENE-041111-204
Description:
mitochondrial trifunctional protein, alpha subunit [Source:RefSeq peptide;Acc:NP_001082906]
Human Orthologue:
HADHA
Human Description:
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), a
Mouse Orthologue:
Hadha
Mouse Description:
hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trif

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17706 Nonsense Available for shipment Available now
sa11167 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076009 Nonsense 124 763 5 20

The following transcripts of ENSDARG00000060594 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 37399061)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37283958
GRCz11 17 37231543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGGCCTGYAAGACCGCAGAGGAGGTCASTGGTCTTTCTCAAGAGGGY[C/T]AGAGGATGTTTGAGAAGATYGAGAAGTCYCCTAAGCCAATTGTTGCTGCY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11167
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076009 Essential Splice Site 191 763 None 20

The following transcripts of ENSDARG00000060594 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 37402124)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37287021
GRCz11 17 37234606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGGCCTGCTGCCCGGAGCTGGAGGAACACAGAGACTCCCCAAAATGG[T/A]TTGTAATTTGWCGTAATTAGTGATAATTCTCTTGATCAGTTCTCRTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link