si:dkey-226m8.9

Ensembl ID:
ENSDARG00000060584
ZFIN ID:
ZDB-GENE-060526-260
Description:
KN motif and ankyrin repeat domain-containing protein 1 [Source:RefSeq peptide;Acc:NP_001103695]
Human Orthologue:
KANK1
Human Description:
KN motif and ankyrin repeat domains 1 [Source:HGNC Symbol;Acc:19309]
Mouse Orthologue:
Kank1
Mouse Description:
KN motif and ankyrin repeat domains 1 Gene [Source:MGI Symbol;Acc:MGI:2147707]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11318 Nonsense Available for shipment Available now
sa16378 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085512 Nonsense 373 1054 2 8
ENSDART00000144273   None 656 None 10
ENSDART00000144694   None 45 None 3

The following transcripts of ENSDARG00000060584 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 34849118)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32631067
GRCz11 5 33231220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCAGCCTTCAAGWTGARGGATCGAGAGTCTGTTRACAGGGGCATTGAT[G/T]AAGMCTTTTGTAAGGATGGTACCATTGGTGCAAAACTTSAGACTCAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085512 Nonsense 825 1054 3 8
ENSDART00000144273 Missense 412 656 5 10
ENSDART00000144694   None 45 None 3

The following transcripts of ENSDARG00000060584 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 34846392)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 32628341
GRCz11 5 33228494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGCGTGCCAAACTCTCGAGATTCACCTCAATGGCAGCAAGACCATA[T/A]CCAATAGAGAACATGTAAGNNNNNNNNNNNNNNNNNNNATCTGAGATGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link