zgc:158645

Ensembl ID:
ENSDARG00000060581
ZFIN ID:
ZDB-GENE-070112-2122
Description:
ubiquitin-associated domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_001074030]
Human Orthologue:
UBAC2
Human Description:
UBA domain containing 2 [Source:HGNC Symbol;Acc:20486]
Mouse Orthologue:
Ubac2
Mouse Description:
ubiquitin associated domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1916139]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4848 Essential Splice Site F2 line generated During 2018
sa17846 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4848
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085514 Essential Splice Site 93 349 3 9
ENSDART00000140806 Essential Splice Site 94 350 3 9
Genomic Location (Zv9):
Chromosome 1 (position 29615628)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29755440
GRCz11 1 30559371
KASP Assay ID:
554-3497.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACAATTTCCGCATATTTGAGAGAAGGTTTGGCAGCCACAAATTTGCTG[T/C]AAGTATTRGGTGTCAATGGTGGCTTTTTGTGTGCGTCTGCCTGTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085514 Essential Splice Site 271 349 7 9
ENSDART00000140806 Essential Splice Site 272 350 7 9
Genomic Location (Zv9):
Chromosome 1 (position 29603242)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29742963
GRCz11 1 30546894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCAGCTGGCACACTTCAGAAGAAATRCACAGCAACAGCAGGCTCAGG[T/C]ACTTCTATTGTTCTTTTATTRAATTTGCTGAATTTTCAGGGTGTGCTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Basal cell carcinoma : Genome-wide association study identifies novel alleles associated with risk of cutaneous basal cell carcinoma and squamous cell carcinoma. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link