si:dkey-38k3.3

Ensembl ID:
ENSDARG00000060580
ZFIN ID:
ZDB-GENE-070424-242
Description:
threonine aspartase 1 [Source:RefSeq peptide;Acc:NP_001094423]
Human Orthologue:
TASP1
Human Description:
taspase, threonine aspartase, 1 [Source:HGNC Symbol;Acc:15859]
Mouse Orthologue:
Tasp1
Mouse Description:
taspase, threonine aspartase 1 Gene [Source:MGI Symbol;Acc:MGI:1923062]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22345 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085499 Essential Splice Site 129 409 4 13
ENSDART00000133661 Essential Splice Site 129 409 5 14

The following transcripts of ENSDARG00000060580 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 34919293)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 34570337
GRCz11 13 34696343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATGGATGGCAAATCCTTAAACTATGGAGCCGTTGGAGCCTTGAGTG[G/A]TGAGTGCATCTATAAACATTATTAAGGCTGCTTTGAGCTTGTCACAATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link