slc25a21

Ensembl ID:
ENSDARG00000060564
ZFIN ID:
ZDB-GENE-060929-664
Description:
mitochondrial 2-oxodicarboxylate carrier [Source:RefSeq peptide;Acc:NP_001070100]
Human Orthologue:
SLC25A21
Human Description:
solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Slc25a21
Mouse Description:
solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 Gene [Source:MGI Symbol

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14376 Essential Splice Site Available for shipment Available now
sa36477 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14376
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085481 Essential Splice Site 89 298 5 11
Genomic Location (Zv9):
Chromosome 17 (position 38372082)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38256979
GRCz11 17 38204564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAATCCTTCCCCCCATTTTGGCCRAGACCCCAAAAAGAGCAGTGAAGG[T/C]AACAGGAACAGCATTTGAYTCCAAGCTKAAACCCATCACTTAAACTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085481 Essential Splice Site 145 298 7 11
Genomic Location (Zv9):
Chromosome 17 (position 38380821)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 38265718
GRCz11 17 38213303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTAGTGAAAGTGAGCCTACAGGCCAACAGGGATTCATTCAAAGTGG[T/A]AAGAGGCTGCAGCTGCTAATTGTCATCACGCTATTGTTTTTGGCTTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link