
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000060557
- Ensembl ID:
- ENSDARG00000060557
- Human Orthologues:
- KIF2A, KIF2B
- Human Descriptions:
- kinesin family member 2B [Source:HGNC Symbol;Acc:29443]
- kinesin heavy chain member 2A [Source:HGNC Symbol;Acc:6318]
- Mouse Orthologues:
- Kif2a, Kif2b
- Mouse Descriptions:
- kinesin family member 2A Gene [Source:MGI Symbol;Acc:MGI:108390]
- kinesin family member 2B Gene [Source:MGI Symbol;Acc:MGI:1920720]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30527 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30527
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085358 | Essential Splice Site | 52 | 694 | 2 | 23 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA534 (position 21253)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 45533140 GRCz11 10 45379752 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTGTGACGGTGGAGTGGATCGAGAATGGCGACACCAAAGGGAAGGAGG[T/C]GAAGCATGTTCATGTTCAGCTGTCCATCAGTCTCATTGCTGGAGCTCATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: