TMC8

Ensembl ID:
ENSDARG00000060545
Description:
transmembrane channel-like 8 [Source:HGNC Symbol;Acc:20474]
Human Orthologue:
TMC8
Human Description:
transmembrane channel-like 8 [Source:HGNC Symbol;Acc:20474]
Mouse Orthologue:
Tmc8
Mouse Description:
transmembrane channel-like gene family 8 Gene [Source:MGI Symbol;Acc:MGI:2669037]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27837 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27838 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa27837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085448 Essential Splice Site 187 619 4 15
Genomic Location (Zv9):
Chromosome 11 (position 45854902)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44795965
GRCz11 11 45210359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGCATGGTCTCCATCATCTTCCTCAGCATCATCATGCTGGTGCGCAG[G/A]TCAGATCCTCTACTGTTCTGATAATACACTGATAATTATTGATTCAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085448 Essential Splice Site 187 619 4 15
Genomic Location (Zv9):
Chromosome 11 (position 45854903)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 44795964
GRCz11 11 45210358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCATGGTCTCCATCATCTTCCTCAGCATCATCATGCTGGTGCGCAGG[T/G]CAGATCCTCTACTGTTCTGATAATACACTGATAATTATTGATTCAAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link