zgc:136936

Ensembl ID:
ENSDARG00000060515
ZFIN ID:
ZDB-GENE-071004-8
Description:
palmitoyltransferase ZDHHC9 [Source:RefSeq peptide;Acc:NP_001103496]
Human Orthologue:
ZDHHC9
Human Description:
zinc finger, DHHC-type containing 9 [Source:HGNC Symbol;Acc:18475]
Mouse Orthologue:
Zdhhc9
Mouse Description:
zinc finger, DHHC domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2444393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31996 Nonsense Available for shipment Available now
sa28336 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31996
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085335 Nonsense 10 382 1 9
Genomic Location (Zv9):
Chromosome 14 (position 34500377)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33185077
GRCz11 14 33525391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCGCTACCATGTCGGCGGTGATGATAACGCGGAAGATCACTCGAAAAT[G/A]GGAGAAATTACCTGGGAAAAACACCTTCTGCTGCGATGGACGGGTAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085335 Essential Splice Site 255 382 6 9
Genomic Location (Zv9):
Chromosome 14 (position 34532545)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33217245
GRCz11 14 33557559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTTTCACACCTATTTGATCTCCCTCAATCAGACCACCAATGAGGACG[T/G]AAGTGTGTTTTTTACCTGTCATTTTTACAGTTTGCTGTTTTCACATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link