sos2

Ensembl ID:
ENSDARG00000060506
ZFIN IDs:
ZDB-GENE-090312-94, ZDB-GENE-090319-5, ZDB-GENE-090319-5, ZDB-GENE-090319-5
Description:
Novel protein similar to H.sapiens son of sevenless homolog [Source:UniProtKB/TrEMBL;Acc:B8A6E4]
Human Orthologue:
SOS2
Human Description:
son of sevenless homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:11188]
Mouse Orthologue:
Sos2
Mouse Description:
son of sevenless homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:98355]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42254 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22352 Nonsense Available for shipment Available now
sa7375 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42254
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085319 Essential Splice Site 618 1345 10 23
ENSDART00000131600 Essential Splice Site 615 1076 10 20
ENSDART00000142911   None 213 None 2
Genomic Location (Zv9):
Chromosome 13 (position 37054152)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36526454
GRCz11 13 36652286
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGACAGTGGTCAAGCTCATTGAGAGACTGACGTACCACATGTACGCAGG[T/C]ACAAAACAAAACCCTCCTTTATATCAAAAGGATTTTTAAGGTCGTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085319 Nonsense 848 1345 16 23
ENSDART00000131600 Nonsense 845 1076 16 20
ENSDART00000142911   None 213 None 2
Genomic Location (Zv9):
Chromosome 13 (position 37046450)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36518752
GRCz11 13 36644584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTATTTTCTCCATTCTCAGGTGTATAGTAGAGGCTGAAAATGTAGAC[G/T]AGAGGGTTGCTGTATTTTCTCGCATTATTGAGATCCTGCAGGTGTTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085319 Missense 1308 1345 23 23
ENSDART00000131600   None 1076 None 20
ENSDART00000142911 Missense 176 213 2 2
Genomic Location (Zv9):
Chromosome 13 (position 37042296)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36514598
GRCz11 13 36640430
KASP Assay ID:
554-4173.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCGACACCGGCACCTCCCATCCCGCCTCGGCACAACTCCACCTCCGCCC[T/A]GCCAAAACTGCCACCCAAGACTTACAAAAGAGAACTGTCTCAATCTTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link