zgc:153328

Ensembl ID:
ENSDARG00000060489
ZFIN ID:
ZDB-GENE-060825-188
Description:
39S ribosomal protein L32, mitochondrial [Source:RefSeq peptide;Acc:NP_001038905]
Human Orthologue:
MRPL32
Human Description:
mitochondrial ribosomal protein L32 [Source:HGNC Symbol;Acc:14035]
Mouse Orthologues:
Gm6578, Mrpl32
Mouse Descriptions:
mitochondrial ribosomal protein L32 Gene [Source:MGI Symbol;Acc:MGI:2137226]
predicted gene 6578 Gene [Source:MGI Symbol;Acc:MGI:3643037]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36239 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36239
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085282 Nonsense 157 174 3 3
Genomic Location (Zv9):
Chromosome 16 (position 46259536)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43443102
GRCz11 16 43346860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGAGTCTGTGGTGTTGTATGAAAGTGAAAAGCCCTCTGATGCAGAT[C/T]AGGGCAAGCGGATAGTCGAACGCAACAGGAAACGTCCATATTGGTTTAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link