vps8

Ensembl ID:
ENSDARG00000060477
ZFIN ID:
ZDB-GENE-060503-348
Description:
vacuolar protein sorting-associated protein 8 homolog [Source:RefSeq peptide;Acc:NP_001074085]
Human Orthologue:
VPS8
Human Description:
vacuolar protein sorting 8 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29122]
Mouse Orthologue:
Vps8
Mouse Description:
vacuolar protein sorting 8 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146407]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19514 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041419   None 456 None 15
ENSDART00000101779   None 455 None 15
ENSDART00000131092 Essential Splice Site 1040 1263 35 43
ENSDART00000134311   None 146 None 6
ENSDART00000143639 Essential Splice Site 1064 1412 36 45
ENSDART00000146783   None 235 None 9
Genomic Location (Zv9):
Chromosome 1 (position 29192525)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29401140
GRCz11 1 30205071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGAGGAAAGGAGATGTACAGGGAGCTTTTCAAGTCCTGCTGCAGG[T/C]TTGAGTTTATCACATCACACATGCCTGCAGACAAAAAGAGAGAAAAAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link