im:7154960

Ensembl ID:
ENSDARG00000060442
ZFIN ID:
ZDB-GENE-080225-14
Human Orthologue:
C19orf6
Human Description:
chromosome 19 open reading frame 6 [Source:HGNC Symbol;Acc:17039]
Mouse Orthologue:
ORF61
Mouse Description:
open reading frame 61 Gene [Source:MGI Symbol;Acc:MGI:2177957]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14860 Nonsense Available for shipment Available now
sa35049 Nonsense Mutation detected in F1 DNA During 2018
sa5840 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Nonsense 253 694 4 11
Genomic Location (Zv9):
Chromosome 11 (position 14325930)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14027226
GRCz11 11 14084885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAATATTCTTTGGAATATGGTTTCCTAAGGCTATCCCAGGCCACACGT[C/T]AACGACTCAACATCCCTGTTATGGTGGTGACCCTTGGTAAGTATTGATNNCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Nonsense 254 694 4 11
Genomic Location (Zv9):
Chromosome 11 (position 14325927)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14027223
GRCz11 11 14084882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATTCTTTGGAATATGGTTTCCTAAGGCTATCCCAGGCCACACGTCAA[C/T]GACTCAACATCCCTGTTATGGTGGTGACCCTTGGTAAGTATTGATCCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085158 Essential Splice Site 306 694 5 11
Genomic Location (Zv9):
Chromosome 11 (position 14323058)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14024354
GRCz11 11 14082013
KASP Assay ID:
554-3951.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTAATGTCCAGTGTGAAGGCATTAGCAGAGAATGAGGAAAACAAAGG[T/C]AAACAATTACGTGTTCTCCCAAAAGATCAGTGCTTCCTTCTTGAGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link