
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:6903943
- Ensembl ID:
- ENSDARG00000060439
- ZFIN ID:
- ZDB-GENE-050506-73
- Human Orthologue:
- CLCN2
- Human Description:
- chloride channel 2 [Source:HGNC Symbol;Acc:2020]
- Mouse Orthologue:
- Clcn2
- Mouse Description:
- chloride channel 2 Gene [Source:MGI Symbol;Acc:MGI:105061]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa42631 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36004 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa42631
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085136 | Nonsense | 102 | 810 | 4 | 23 |
- Genomic Location (Zv9):
- Chromosome 15 (position 46113976)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 46535594 GRCz11 15 46769811 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCCCACAGGTGGATCTACTACAGTGTGGCGGATTATCATGTTGTGGTG[C/T]AGTATCTGGTGTGGGTCTCATATTCCATGATCCTCATGTGTTTCGCTGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36004
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085136 | Nonsense | 598 | 810 | 17 | 23 |
- Genomic Location (Zv9):
- Chromosome 15 (position 46093469)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 46515087 GRCz11 15 46749304 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTTTTGACTGTGTTTCTCAGAGTCGATGCTGCTTTTGGGCTCTATTGAG[C/T]GAGCTCAGTTGTTGGCGCTCCTGATAGAGCGAACGCAATACCTGCGGGGC
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: