zfyve28

Ensembl ID:
ENSDARG00000060430
ZFIN ID:
ZDB-GENE-061103-208
Description:
Lateral signaling target protein 2 homolog [Source:UniProtKB/Swiss-Prot;Acc:A0JMD2]
Human Orthologue:
ZFYVE28
Human Description:
zinc finger, FYVE domain containing 28 [Source:HGNC Symbol;Acc:29334]
Mouse Orthologue:
Zfyve28
Mouse Description:
zinc finger, FYVE domain containing 28 Gene [Source:MGI Symbol;Acc:MGI:2684992]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14866 Essential Splice Site Available for shipment Available now
sa11552 Nonsense Available for shipment Available now
sa32170 Nonsense Available for shipment Available now
sa36500 Nonsense Mutation detected in F1 DNA During 2018
sa36499 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085124 Essential Splice Site 174 971 5 15
ENSDART00000139980 Essential Splice Site 174 975 5 14
Genomic Location (Zv9):
Chromosome 17 (position 43626838)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43591513
GRCz11 17 43582051
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTGTATACATTAACATKTTGTAATGATATCCCATATCTGTTTGCTGT[A/T]GTTATGTGTCRGCCATGGTGCCTGTGAAGTCTCCTAASGAGTATTACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085124 Nonsense 477 971 9 15
ENSDART00000139980 Nonsense 483 975 8 14
Genomic Location (Zv9):
Chromosome 17 (position 43620974)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43585649
GRCz11 17 43576187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCCCCYGAGGGATCANNNNNNNNNNNNNNNNNNTCCTGTAATGGTTG[G/A]TTGACAGTCTGCCAATCGAGCGACGYCACCAATTTGGGTTGTCAGCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085124 Nonsense 483 971 9 15
ENSDART00000139980 Nonsense 489 975 8 14
Genomic Location (Zv9):
Chromosome 17 (position 43620957)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43585632
GRCz11 17 43576170
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGTAGACCCGACGCATCCTGTAATGGTTGGTTGACAGTCTGCCAAT[C/A]GAGCGACGCCACCAATTTGGGTTGTCAGCGCAAACTGAGCCAATCAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085124 Nonsense 711 971 9 15
ENSDART00000139980 Nonsense 717 975 8 14
Genomic Location (Zv9):
Chromosome 17 (position 43620273)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43584948
GRCz11 17 43575486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTAGTTGCACCCTTCAGGACACAGGATGCCGAACGCAACATAATGCCT[C/A]AGTAAAAGGGAAATCGGAATGTTTTGGAAAACAGTCCAAAGATGATAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085124 Essential Splice Site 732 971 10 15
ENSDART00000139980 Essential Splice Site 738 975 9 14
Genomic Location (Zv9):
Chromosome 17 (position 43619731)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 43584406
GRCz11 17 43574944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTTTCTTTTGTTGCCGCCTCATGTTTTTTGTTTTGGAATGGTCCACA[G/T]CAGTTCTCAGGAGTCCCCCCTCAGTTCTGTACCCAGCAGTGACATTGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Schizophrenia: Genome-wide association study of clinical dimensions of schizophrenia: polygenic effect on disorganized symptoms. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link