THBS2 (1 of 3)

Ensembl ID:
ENSDARG00000060410
Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Human Orthologue:
THBS2
Human Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Mouse Orthologue:
Thbs2
Mouse Description:
thrombospondin 2 Gene [Source:MGI Symbol;Acc:MGI:98738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35548 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085037 Nonsense 1091 1173 18 20
Genomic Location (Zv9):
Chromosome 13 (position 35893810)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35546386
GRCz11 13 35672218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGGAGAGCACCTTCGCAATGCCCTGTGGCACACTGGGGACACACCT[G/T]GACAGGTCAGACTGATCAGATATTATTTACAGTTGAAGTGGGACGAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link