si:dkey-54o1.1

Ensembl ID:
ENSDARG00000060393
ZFIN ID:
ZDB-GENE-070424-245
Description:
hypothetical protein LOC567525 [Source:RefSeq peptide;Acc:NP_001122015]
Human Orthologue:
FIBCD1
Human Description:
fibrinogen C domain containing 1 [Source:HGNC Symbol;Acc:25922]
Mouse Orthologue:
Fibcd1
Mouse Description:
fibrinogen C domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2138953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44610 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44610
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085041 Essential Splice Site 294 440 5 6
ENSDART00000146321 Splice Site None 461 None 7

The following transcripts of ENSDARG00000060393 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 35692690)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 33474639
GRCz11 5 34074792
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAAAATAATAAATAAAATAATTGCTCTCTTTTTTTCTCTCTCTCTCA[T/G]CAGGGTTGAAACAGATCCATGCTCTCTCTATCCAAGGAAACTATGAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link