coq6

Ensembl ID:
ENSDARG00000060380
ZFIN ID:
ZDB-GENE-060825-297
Description:
ubiquinone biosynthesis monooxygenase COQ6 [Source:RefSeq peptide;Acc:NP_001038869]
Human Orthologue:
COQ6
Human Description:
coenzyme Q6 homolog, monooxygenase (S. cerevisiae) [Source:HGNC Symbol;Acc:20233]
Mouse Orthologue:
Coq6
Mouse Description:
coenzyme Q6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1924408]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45620 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085009 Nonsense 152 484 4 12

The following transcripts of ENSDARG00000060380 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 45183036)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 44902909
GRCz11 17 45016674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGGATGCTTGTTCGGATGCCCTGATTACATTTGATAAGGAGAATCTG[C/T]AGGACGAGATGGCATACATCGTTGAGAACGACGTCATTGTGGCCGCCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link