syn1

Ensembl ID:
ENSDARG00000060368
ZFIN ID:
ZDB-GENE-081105-93
Description:
synapsin-1 [Source:RefSeq peptide;Acc:NP_001119909]
Human Orthologue:
SYN1
Human Description:
synapsin I [Source:HGNC Symbol;Acc:11494]
Mouse Orthologue:
Syn1
Mouse Description:
synapsin I Gene [Source:MGI Symbol;Acc:MGI:98460]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21334 Nonsense Available for shipment Available now
sa14827 Nonsense Mutation detected in F1 DNA During 2018
sa7143 Nonsense Mutation detected in F1 DNA During 2018
sa34436 Nonsense Mutation detected in F1 DNA During 2018
sa12369 Nonsense Available for shipment Available now
sa21335 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 212 670 5 13
ENSDART00000136578 Nonsense 212 670 6 14
Genomic Location (Zv9):
Chromosome 8 (position 31976751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31119477
GRCz11 8 31128709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATATGTCTCGATGTGATTGTTTGTTCTTTCAGTTCTCTCAGTTGTCC[A/T]GATTGTACAAGCAGTTGGGTCCAGAGGAGTTCCCACTGATCGACCAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
Genomic Location (Zv9):
Chromosome 8 (position 31979404)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31122130
GRCz11 8 31131362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGCTTTGACAAAGACGTATGCCACATCTGAGCCTTTTATTGATGCC[A/G]AGTATGACATCCKAATCCAGAAAATTGGGGAMAATTACAAGGCCTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
ENSDART00000084969 Nonsense 289 670 7 13
ENSDART00000136578 Nonsense 289 670 8 14
Genomic Location (Zv9):
Chromosome 8 (position 31979404)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31122130
GRCz11 8 31131362
KASP Assay ID:
554-5053.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGGCTTTGACAAAGACGTATGCCACATCTGAGCCTTTTATTGATGCC[A/T]AGTATGACATCCGAATCCAGAAAATTGGGGAAAATTACAAGGCCTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 359 670 9 13
ENSDART00000136578 Nonsense 359 670 10 14
Genomic Location (Zv9):
Chromosome 8 (position 31983733)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31126459
GRCz11 8 31135691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGGGTCTCGATATATGCGCTGTTGAAGCACTGCATGGTAAAGACGGT[C/T]GAGATTACATAATAGAGGTAATGACATCTGCAAAAACAGGCAGCTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 480 670 12 13
ENSDART00000136578 Nonsense 480 670 13 14
Genomic Location (Zv9):
Chromosome 8 (position 31990192)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31132918
GRCz11 8 31142150
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCAATCCCAGTCTGTGACCAGCCCTATTGCTCAGAATCCACCTGCTCAA[C/T]AACCGCGGCCCAATCAACCGCCCCAGCGACAGGCCAGTCAAGGTTCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21335
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084969 Nonsense 608 670 12 13
ENSDART00000136578 Nonsense 608 670 13 14
Genomic Location (Zv9):
Chromosome 8 (position 31990576)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31133302
GRCz11 8 31142534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCCCAGGAGGCACACGCCCTCCCTTGCAGCAGAAACCCCAACCTCCA[C/T]AGAAACCCAGTCCTGATCACCCTGCCTTGAGTGGATCACCGCAGCTTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link