zgc:153593

Ensembl ID:
ENSDARG00000060345
ZFIN ID:
ZDB-GENE-060929-148
Description:
hypothetical protein LOC767642 [Source:RefSeq peptide;Acc:NP_001070050]
Human Orthologue:
APOD
Human Description:
apolipoprotein D [Source:HGNC Symbol;Acc:612]
Mouse Orthologue:
Apod
Mouse Description:
apolipoprotein D Gene [Source:MGI Symbol;Acc:MGI:88056]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2028 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa2028
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084938 Nonsense 143 185 5 5
Genomic Location (Zv9):
Chromosome 2 (position 36929020)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37225730
GRCz11 2 37208187
KASP Assay ID:
554-2489.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTATTCCTGCASTGATGTCTTNNNNNNNNNCCATGTAGACTTTGCTTG[G/A]ATTTTGGGACGCACCCGATCCCTGCCTGCTGCCACCATTGAACATGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link