
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:153654
- Ensembl ID:
- ENSDARG00000060322
- ZFIN ID:
- ZDB-GENE-060929-1102
- Description:
- hypothetical protein LOC565601 [Source:RefSeq peptide;Acc:NP_001070637]
- Human Orthologues:
- IFI44, IFI44L
- Human Descriptions:
- interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
- interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
- Mouse Orthologues:
- H28, Ifi44
- Mouse Descriptions:
- histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
- interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15481 | Nonsense | Available for shipment | Available now |
sa16411 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15481
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084876 | Nonsense | 190 | 445 | 4 | 8 |
ENSDART00000114157 | Nonsense | 190 | 283 | 4 | 9 |
ENSDART00000123695 | Nonsense | 190 | 445 | 3 | 7 |
- Genomic Location (Zv9):
- Chromosome 2 (position 36637977)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 36934687 GRCz11 2 36917144 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTTAATGTCTTAGGAAAAAGAAGGCACTCTTGAGCTCCATCTCCAGCTGG[A/T]AGCCTTCTGTGAGCTCAATTAAACAGGCTCGGATTCTKTTGSTGGGTCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16411
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084876 | Nonsense | 405 | 445 | 8 | 8 |
ENSDART00000114157 | None | 283 | 9 | 9 | |
ENSDART00000123695 | Nonsense | 405 | 445 | 7 | 7 |
- Genomic Location (Zv9):
- Chromosome 2 (position 36636142)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 36932852 GRCz11 2 36915309 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCACTCAGCTTGGAGTTTCTCTGTCTGCTGTGGTTCCAGTGAAAAATTA[T/A]TGCCAAGAACTGGAAATAGACCCTCAAACCGACATACTGCTCCTGAATGG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Autism spectrum disorder, attention deficit-hyperactivity disorder, bipolar disorder, major depressive disorder, and schizophrenia (combined): Identification of risk loci with shared effects on five major psychiatric disorders: a genome-wide analysis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: