zgc:153654

Ensembl ID:
ENSDARG00000060322
ZFIN ID:
ZDB-GENE-060929-1102
Description:
hypothetical protein LOC565601 [Source:RefSeq peptide;Acc:NP_001070637]
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15481 Nonsense Available for shipment Available now
sa16411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084876 Nonsense 190 445 4 8
ENSDART00000114157 Nonsense 190 283 4 9
ENSDART00000123695 Nonsense 190 445 3 7
Genomic Location (Zv9):
Chromosome 2 (position 36637977)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36934687
GRCz11 2 36917144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAATGTCTTAGGAAAAAGAAGGCACTCTTGAGCTCCATCTCCAGCTGG[A/T]AGCCTTCTGTGAGCTCAATTAAACAGGCTCGGATTCTKTTGSTGGGTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16411
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084876 Nonsense 405 445 8 8
ENSDART00000114157   None 283 9 9
ENSDART00000123695 Nonsense 405 445 7 7
Genomic Location (Zv9):
Chromosome 2 (position 36636142)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36932852
GRCz11 2 36915309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCACTCAGCTTGGAGTTTCTCTGTCTGCTGTGGTTCCAGTGAAAAATTA[T/A]TGCCAAGAACTGGAAATAGACCCTCAAACCGACATACTGCTCCTGAATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link