Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-193b15.6
- Ensembl ID:
- ENSDARG00000060315
- ZFIN ID:
- ZDB-GENE-070912-414
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S6B7]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa16529 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa16529
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084859 | Nonsense | 113 | 320 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 2 (position 36621863)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 36918573 GRCz11 2 36901030 - KASP Assay ID:
- 2259-2327.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TACAGACCGAGGACCAAGTGGWTGAATTGRCCAAGGAGCTTTCAAAAGTC[A/T]AACAGCTTCTTGTGGTAACAGAGGAGGAGAAGCGAGRAAAAGAGGAGGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
