
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-255e3.1
- Ensembl ID:
- ENSDARG00000060303
- ZFIN ID:
- ZDB-GENE-081105-62
- Description:
- Novel protein similar to vertebrate solute carrier family 4, sodium bicarbonate cotransporter protei
- Human Orthologue:
- SLC4A10
- Human Description:
- solute carrier family 4, sodium bicarbonate transporter, member 10 [Source:HGNC Symbol;Acc:13811]
- Mouse Orthologue:
- Slc4a10
- Mouse Description:
- solute carrier family 4, sodium bicarbonate cotransporter-like, member 10 Gene [Source:MGI Symbol;Ac
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa6119 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa15332 | Nonsense | Available for shipment | Available now |
sa13363 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa6119
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084806 | Essential Splice Site | 76 | 900 | 2 | 21 |
ENSDART00000139316 | None | 573 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 9 (position 52701570)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 51823792 GRCz11 9 51355205 - KASP Assay ID:
- 554-3707.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGCTGACATCGGCAAGAAGCAGTCAGAGTCCAACTGCTTGGACAAAAACG[G/A]TACTCGATTACCATCATTCAGAATTCACAGAAGGTATTSGTGTTATTACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15332
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084806 | Nonsense | 174 | 900 | 5 | 21 |
ENSDART00000139316 | None | 573 | None | 11 |
- Genomic Location (Zv9):
- Chromosome 9 (position 52687019)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 51809241 GRCz11 9 51340654 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCAGGTTTCTGTTCATCCTTCTCGGACCTCTGGGAAAAGGAGCTCAGTA[T/A]CACGAGATYGGCAGATCCATCGCAACCTTGATGACAGATGAGGTATCTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13363
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000084806 | Nonsense | 747 | 900 | 17 | 21 |
ENSDART00000139316 | Nonsense | 479 | 573 | 10 | 11 |
- Genomic Location (Zv9):
- Chromosome 9 (position 52648829)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 51771141 GRCz11 9 51302564 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGACATGTTTRCTTCTGCTTTTTCTYGTGATCTTAGTTTTTCGAYCGTT[T/A]GAGATTGTTCGGGATGCCGGCTAAACAYCAGCCAGACTTCATTTACCTGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: