si:ch211-282c13.6

Ensembl ID:
ENSDARG00000060298
ZFIN IDs:
ZDB-GENE-070725-1, ZDB-GENE-070725-1, ZDB-GENE-090312-130
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A6H4]
Human Orthologue:
NIN
Human Description:
ninein (GSK3B interacting protein) [Source:HGNC Symbol;Acc:14906]
Mouse Orthologue:
Nin
Mouse Description:
ninein Gene [Source:MGI Symbol;Acc:MGI:105108]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11160 Essential Splice Site Available for shipment Available now
sa11058 Nonsense Available for shipment Available now
sa45496 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084815 Essential Splice Site 323 741 9 16
ENSDART00000112007 Essential Splice Site 323 1272 8 24
ENSDART00000129562   None 340 None 8
Genomic Location (Zv9):
Chromosome 13 (position 37231553)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36703855
GRCz11 13 36829687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATTACAGGAWGTTTTTAATKAGCTTTTATGCATGCTTTTTATTTTGT[A/G]GGCTCTGGATTTTAATCTGGAAGGTAAAGTGAATCTGTCGGAGCTCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084815 Nonsense 465 741 11 16
ENSDART00000112007 Nonsense 465 1272 10 24
ENSDART00000129562   None 340 None 8
Genomic Location (Zv9):
Chromosome 13 (position 37228133)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36700435
GRCz11 13 36826267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCTTGAACAAGAAATTAGCAAGATGAGAGATGATGAAACCTTCCTA[C/T]GAGAACACCTAACGCTTACCATTAAAGTAATCATCACTGATTTCATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084815   None 741 None 16
ENSDART00000112007 Nonsense 906 1272 15 24
ENSDART00000129562   None 340 None 8
Genomic Location (Zv9):
Chromosome 13 (position 37223616)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36695918
GRCz11 13 36821750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTCAACTAGAGAGGCAGCACAAGGAGGCGCTCCAGGCCTGTTTGGAG[C/T]AGGAGCGAGAGAGACTGCAGGTGGACCGAGAGGAGCAGGAGAGCAGGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link