si:dkey-37g12.1

Ensembl ID:
ENSDARG00000060264
ZFIN ID:
ZDB-GENE-090312-145
Description:
Novel protein similar to H.sapiens natriuretic peptide receptor [Source:UniProtKB/TrEMBL;Acc:B8JI41]
Human Orthologues:
GUCY2C, GUCY2D, GUCY2F
Human Descriptions:
guanylate cyclase 2C (heat stable enterotoxin receptor) [Source:HGNC Symbol;Acc:4688]
guanylate cyclase 2D, membrane (retina-specific) [Source:HGNC Symbol;Acc:4689]
guanylate cyclase 2F, retinal [Source:HGNC Symbol;Acc:4691]
Mouse Orthologues:
Gucy2c, Gucy2d, Gucy2e, Gucy2f
Mouse Descriptions:
guanylate cyclase 2c Gene [Source:MGI Symbol;Acc:MGI:106903]
guanylate cyclase 2d Gene [Source:MGI Symbol;Acc:MGI:106030]
guanylate cyclase 2e Gene [Source:MGI Symbol;Acc:MGI:105123]
guanylate cyclase 2f Gene [Source:MGI Symbol;Acc:MGI:105119]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32730 Nonsense Mutation detected in F1 DNA During 2018
sa17109 Nonsense Available for shipment Available now
sa15761 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084735 Nonsense 409 1042 11 29
ENSDART00000140845   None 320 None 9
Genomic Location (Zv9):
Chromosome 1 (position 42277127)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41193443
GRCz11 1 41894607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGAGCTAAACTATATGATGAAACAGATCAGAGGTAGCAATAACCAATG[T/A]CAGGTGAGATATTACCATTAGCTGACTGACTAAATACAAATACACAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084735 Nonsense 550 1042 17 29
ENSDART00000140845   None 320 None 9
Genomic Location (Zv9):
Chromosome 1 (position 42281450)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41197766
GRCz11 1 41898930
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATTCATAGTTCAGTTAATTAAATCTTTCTTCTTCAGGGCACAATTTG[T/A]TCTGTTTCCTTCGTAAATCTGAGAAGCACACATCTGAACAGCGAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084735 Nonsense 635 1042 20 29
ENSDART00000140845   None 320 None 9
Genomic Location (Zv9):
Chromosome 1 (position 42283730)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 41200046
GRCz11 1 41901210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAYAACTATTATGGCTAATTTCTTTGACTCTGGTGTAGGGCATGGACTA[T/A]TTGCACCATAGTCCCCTGCAGTATCATGGYCACCTGTCATCCKCCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link