zgc:162160

Ensembl ID:
ENSDARG00000060259
ZFIN ID:
ZDB-GENE-070424-22
Description:
hypothetical protein LOC561782 [Source:RefSeq peptide;Acc:NP_001082862]
Human Orthologues:
KCNJ6, KCNJ9
Human Descriptions:
potassium inwardly-rectifying channel, subfamily J, member 6 [Source:HGNC Symbol;Acc:6267]
potassium inwardly-rectifying channel, subfamily J, member 9 [Source:HGNC Symbol;Acc:6270]
Mouse Orthologues:
Kcnj6, Kcnj9
Mouse Descriptions:
potassium inwardly-rectifying channel, subfamily J, member 6 Gene [Source:MGI Symbol;Acc:MGI:104781]
potassium inwardly-rectifying channel, subfamily J, member 9 Gene [Source:MGI Symbol;Acc:MGI:108007]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36231 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084730 Nonsense 132 432 3 4
Genomic Location (Zv9):
Chromosome 16 (position 44977456)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42257964
GRCz11 16 42207996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCGCCTACGCCCGAGGAGATCTGGAGCACACTGATGATAATGACTG[G/A]ACACCTTGTGTGAATAACCTCAATGGCTTCGTCTCAGCGTTTCTTTTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link