ZRANB1 (1 of 2)

Ensembl ID:
ENSDARG00000060257
Description:
zinc finger, RAN-binding domain containing 1 [Source:HGNC Symbol;Acc:18224]
Human Orthologue:
ZRANB1
Human Description:
zinc finger, RAN-binding domain containing 1 [Source:HGNC Symbol;Acc:18224]
Mouse Orthologue:
Zranb1
Mouse Description:
zinc finger, RAN-binding domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:106441]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22175 Nonsense Available for shipment Available now
sa13741 Nonsense Available for shipment Available now
sa22176 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084714 Nonsense 212 666 2 11
Genomic Location (Zv9):
Chromosome 12 (position 48166080)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47108959
GRCz11 12 47055715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCGGAGCTCACAGCCGCCCAGAGGAGATGGACTTCAAGAAGATCAAG[C/T]AGATCAAGAACCGCATGAGGAAAACAGACTGGCTGTTTCTCAACGCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084714 Nonsense 240 666 3 11
Genomic Location (Zv9):
Chromosome 12 (position 48172809)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47115688
GRCz11 12 47062444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNNTGTGTGTGTGTGCAGGTGTAGTTGAAGGAGATCTGTCTGCAGTC[G/T]AGGCCTACAAGTCTTCAGGTGGTGATATTGCACGTCAGCTGAAYGCAGAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22176
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084714 Nonsense 539 666 9 11
Genomic Location (Zv9):
Chromosome 12 (position 48179019)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 47121898
GRCz11 12 47068654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGTGGGAGCAGAGCTTCTGCTGGAAGAGCCCGATCGCTCTGGGCTA[C/A]ACACGAGGTCATTTTTCTGCTTTGGTTGGCATGGAGAGCGACGGCTACGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link