si:dkey-255n6.2

Ensembl ID:
ENSDARG00000060256
ZFIN ID:
ZDB-GENE-100922-251
Human Orthologue:
ALKBH8
Human Description:
alkB, alkylation repair homolog 8 (E. coli) [Source:HGNC Symbol;Acc:25189]
Mouse Orthologue:
Alkbh8
Mouse Description:
alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22924 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084715 Nonsense 113 666 2 11
Genomic Location (Zv9):
Chromosome 16 (position 44942897)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42223405
GRCz11 16 42173437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCAATGGACGAACACTACAGTGTCAGGATCAGACCATGACACTTTA[T/A]TTCAGCTATGTTGTGAAAGGTGCATCACGCGGGACATATTTTAATAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link