Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NP_001093508.1
- Ensembl ID:
- ENSDARG00000060249
- Description:
- hypothetical protein LOC569045 [Source:RefSeq peptide;Acc:NP_001093508]
- Human Orthologue:
- WDR44
- Human Description:
- WD repeat domain 44 [Source:HGNC Symbol;Acc:30512]
- Mouse Orthologue:
- Wdr44
- Mouse Description:
- WD repeat domain 44 Gene [Source:MGI Symbol;Acc:MGI:1919654]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa40506 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40506
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000084675 | Nonsense | 684 | 904 | 14 | 19 |
- Genomic Location (Zv9):
- Chromosome 5 (position 38920413)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 36720097 GRCz11 5 37320250 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATGGAATATTCCTGATAAGAAAGTGGCGCTGTGGAATGAGGTGGATGGA[C/T]AGACGCGTCTGATAACAGCAGCTAACTTCTGCCAGAATGGAAAGTATGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
